Stem-loop sequence tae-MIR9666a

AccessionMI0030388 (change log)
DescriptionTriticum aestivum miR9666a stem-loop
Gene family MIPF0001930; MIR9666
Literature search

3 open access papers mention tae-MIR9666a
(5 sentences)

Stem-loop
   u  u    au            -    a      ca    au      a 
5'  ca ucgg  ucgccaucauac gccc accgug  uuug  augcau u
    || ||||  |||||||||||| |||| ||||||  ||||  ||||||  
3'  gu agcc  agcgguaguaug cggg uggcac  gagc  uacgua a
   g  u    au            u    a      -c    ac      u 
Get sequence
Deep sequencing
120169 reads, 509 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9666a-3p

Accession MIMAT0035778
Sequence

67 - 

cgguagggcuguaugauggcga

 - 88

Get sequence
Deep sequencing118660 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).