Stem-loop sequence tae-MIR5062

AccessionMI0030391 (change log)
DescriptionTriticum aestivum miR5062 stem-loop
Gene family MIPF0001922; MIR5062
Literature search

4 open access papers mention tae-MIR5062
(7 sentences)

Stem-loop
   c      u          a  -   -cag      a  ac   u    u        c  a         aaaacugcucc 
5'  guagcu cuugaaccuu gg gaa    ccgcau ac  cau aacu gaaaacca uu ucuuauccc           u
    |||||| |||||||||| || |||    |||||| ||  ||| |||| |||||||| || |||||||||            
3'  uauugg gaacuuggaa cc cuu    ggcgua ug  gug uuga uuuuuggu aa ggaaugggg           a
   c      u          -  a   uuua      c  ga   u    -        -  -         aauauaacacc 
Get sequence
Deep sequencing
83063 reads, 286 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR5062-5p

Accession MIMAT0035781
Sequence

11 - 

ugaaccuuagggaacagccgcau

 - 33

Get sequence
Deep sequencing66340 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).