Stem-loop sequence tae-MIR9668

AccessionMI0030392 (change log)
DescriptionTriticum aestivum miR9668 stem-loop
Literature search

1 open access papers mention tae-MIR9668
(2 sentences)

Stem-loop
   a        c   ccaa                         auacaagauucgacuccaugaaguagc 
5'  gauacauc auu    ugacaaguauuuucggacggaggga                           u
    |||||||| |||    |||||||||||||||||||||||||                            
3'  cuauguag uaa    gcuguucauaaaggccugucucccu                           u
   -        u   acag                         caaaaaaaauaagauaacgaucuccau 
Get sequence
Deep sequencing
1130898 reads, 3.36e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9668-5p

Accession MIMAT0035782
Sequence

14 - 

ccaaugacaaguauuuucgga

 - 34

Get sequence
Deep sequencing879352 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).