Stem-loop sequence tae-MIR9666c

AccessionMI0030394 (change log)
DescriptionTriticum aestivum miR9666c stem-loop
Gene family MIPF0001930; MIR9666
Literature search

2 open access papers mention tae-MIR9666c
(4 sentences)

Stem-loop
   au    au             u         ca    au      a 
5'   ucgg  ucgccaucauacg ccaaccgug  uuug  augcau u
     ||||  ||||||||||||| |||||||||  ||||  ||||||  
3'   agcc  agcgguaguaugu gguuggcac  gagc  uacgua a
   uu    au             c         -c    gc      u 
Get sequence
Deep sequencing
1541 reads, 0.862 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9666c-5p

Accession MIMAT0035784
Sequence

11 - 

gccaucauacguccaaccgug

 - 31

Get sequence
Deep sequencing1130 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).