Stem-loop sequence tae-MIR1122c

AccessionMI0030398 (change log)
DescriptionTriticum aestivum miR1122c stem-loop
Gene family MIPF0000443; MIR1120
Literature search

8 open access papers mention tae-MIR1122c
(40 sentences)

Stem-loop
   g  a            a           a              a     
5'  ug acuacucucucc ucccauaaugu agacguuuuugcaa cuau 
    || |||||||||||| ||||||||||| |||||||||||||| ||| a
3'  ac ugaugagggagg aggguauuaua ucugcaaaaacguu gauu 
   -  a            c           a              c     
Get sequence
Deep sequencing
91396 reads, 20.7 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3D: 86881594-86881689 [+]
intergenic
Database links

Mature sequence tae-miR1122c-3p

Accession MIMAT0035788
Sequence

66 - 

ucuaauauuaugggacggagg

 - 86

Get sequence
Deep sequencing77447 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).