Stem-loop sequence tae-MIR9672a

AccessionMI0030400 (change log)
DescriptionTriticum aestivum miR9672 stem-loop
Gene family MIPF0001942; MIR9672
Literature search

2 open access papers mention tae-MIR9672a
(3 sentences)

Stem-loop
   ---        aa      a                              aagagccaggcgacuaugucuac 
5'    ucuguuug  gugaag ugaugcuuaaugacagucguggugucuuag                       g
      ||||||||  |||||| ||||||||||||||||||||||||||||||                        
3'    agacaaac  cacuuc gcuacgaauuacugucagcaccacaggauc                       c
   ccg        cc      c                              cguuucugcuacgaauuaccggu 
Get sequence
Deep sequencing
1020236 reads, 4.24e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
5A: 67467149-67467293 [+]
intergenic
Database links

Mature sequence tae-miR9672a-3p

Accession MIMAT0035790
Sequence

104 - 

ccacgacugucauuaagcauc

 - 124

Get sequence
Deep sequencing395978 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).