Stem-loop sequence tae-MIR5175

AccessionMI0030402 (change log)
DescriptionTriticum aestivum miR5175 stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention tae-MIR5175
(14 sentences)

Stem-loop
   -                                     c  a 
5'  acucccucuguuccaaauuacucgucgugguuuuagu ca a
    ||||||||||||||||||||||||||||||||||||| ||  
3'  ugagggaggcaagguuuaaugagcaguaccaaaauca gu u
   a                                     a  u 
Get sequence
Deep sequencing
141378 reads, 228 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2A: 152624513-152624597 [-]
intergenic
Database links

Mature sequence tae-miR5175-5p

Accession MIMAT0035792
Sequence

11 - 

uuccaaauuacucgucguggu

 - 31

Get sequence
Deep sequencing35718 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).