![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tae-MIR5175 |
|||||
Accession | MI0030402 (change log) | ||||
Description | Triticum aestivum miR5175 stem-loop | ||||
Gene family | MIPF0001200; MIR5067 | ||||
Literature search |
![]()
2 open access papers mention tae-MIR5175 | ||||
Stem-loop |
- c a
5' acucccucuguuccaaauuacucgucgugguuuuagu ca a
||||||||||||||||||||||||||||||||||||| ||
3' ugagggaggcaagguuuaaugagcaguaccaaaauca gu u
a a u
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tae-miR5175-5p |
|
Accession | MIMAT0035792 |
Sequence |
11 - uuccaaauuacucgucguggu - 31 |
Deep sequencing | 35718 reads, 116 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24734873
"Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)"
BMC Genomics. 15:289(2014).
|