Stem-loop sequence tae-MIR1130b

AccessionMI0030406 (change log)
DescriptionTriticum aestivum miR1130b stem-loop
Gene family MIPF0000344; MIR818
Literature search

7 open access papers mention tae-MIR1130b
(16 sentences)

Stem-loop
   auu  a        a     c         c     u    a  -ac   a  a 
5'    gu cucccucc uccca aauauaaga guuuu gcaa cu   uug ac u
      || |||||||| ||||| ||||||||| ||||| |||| ||   ||| || c
3'    ca gagggagg agggu uuauauucu caaaa cguu ga   aau ug u
   --u  c        c     a         a     c    c  caa   a  u 
Get sequence
Deep sequencing
137330 reads, 90.5 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3B: 661444562-661444669 [+]
intergenic
Database links

Mature sequence tae-miR1130b-3p

Accession MIMAT0035796
Sequence

81 - 

ucuuauauuaugggacggagg

 - 101

Get sequence
Deep sequencing130657 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).