Stem-loop sequence tae-MIR7757

AccessionMI0030410 (change log)
DescriptionTriticum aestivum miR7757 stem-loop
Gene family MIPF0002033; MIR7757
Literature search

2 open access papers mention tae-MIR7757
(2 sentences)

Stem-loop
   ug     cau          c          cuc      a cc  -u  cu       uugaaaca                 aauauccuugaacauaagaacgagccacacaugcugcaccaauacuaugaaaaguagcauagaaugaguaaaagaggcucuugacuuuuaga 
5'   cauua   auaaaaccuu agcuauccau   cauauc g  ug  cu  cuuaauu        uuuuggaaauaugcuua                                                                                            u
     |||||   |||||||||| ||||||||||   |||||| |  ||  ||  |||||||        |||||||||||||||||                                                                                             
3'   guaau   uauuuuggag uugauaggua   guauag c  ac  ga  gaauuag        aagauuuuuguaugaau                                                                                            c
   ua     auu          u          aau      - uu  uc  ac       --------                 cuguauuauugauuaguauaucuauucuuccgucuaauuucgacgaucaucaaucauuuuuucccaaauggacaucuaguuucgagaacgua 
Get sequence
Deep sequencing
1252544 reads, 5.71e+03 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3D: 111891336-111891679 [-]
intergenic
Database links

Mature sequence tae-miR7757-5p

Accession MIMAT0035800
Sequence

11 - 

auaaaaccuucagcuauccauc

 - 32

Get sequence
Deep sequencing1224273 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).