Stem-loop sequence tae-MIR6197

AccessionMI0030416 (change log)
DescriptionTriticum aestivum miR6197 stem-loop
Literature search

3 open access papers mention tae-MIR6197
(5 sentences)

Stem-loop
   aa   c          a            c     u          
5'   gua ucccucugua acaaauguagga guuuu gcaguuuaa 
     ||| |||||||||| |||||||||||| ||||| |||||||| a
3'   uau agggagacau uguuuacauucu caaaa cgucaaauu 
   ua   a          g            a     u          
Get sequence
Deep sequencing
3688 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
1A: 142658741-142658831 [-]
intergenic
Database links

Mature sequence tae-miR6197-5p

Accession MIMAT0035806
Sequence

11 - 

ucuguaaacaaauguaggacg

 - 31

Get sequence
Deep sequencing2046 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).