Stem-loop sequence tae-MIR9679

AccessionMI0030418 (change log)
DescriptionTriticum aestivum miR9679 stem-loop
Literature search

2 open access papers mention tae-MIR9679
(9 sentences)

Stem-loop
   -       c  c                      --g   cuacu 
5'  gaggcgc uc agaaccagaaugaguagcucau   cac     c
    ||||||| || ||||||||||||||||||||||   |||      
3'  cuucgcg ag uuuuggucuuacucgucgagug   gug     a
   c       u  a                      uaa   auaca 
Get sequence
Deep sequencing
9632 reads, 10.3 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2D: 26660550-26660638 [-]
intergenic
Database links

Mature sequence tae-miR9679-5p

Accession MIMAT0035808
Sequence

11 - 

cagaaccagaaugaguagcuc

 - 31

Get sequence
Deep sequencing9413 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).