Stem-loop sequence tae-MIR9666b

AccessionMI0030421 (change log)
DescriptionTriticum aestivum miR9666b stem-loop
Gene family MIPF0001930; MIR9666
Literature search

2 open access papers mention tae-MIR9666b
(4 sentences)

Stem-loop
   u  u    au            -           ca    au      a 
5'  ca ucgg  ucgccaucauac guccaaccgug  uuug  augcau u
    || ||||  |||||||||||| |||||||||||  ||||  ||||||  
3'  gu agcc  agcgguaguaug cggguuggcac  gagc  uacgua a
   g  u    au            u           -c    ac      u 
Get sequence
Deep sequencing
131089 reads, 522 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2A: 251249264-251249361 [-]
intergenic
Database links

Mature sequence tae-miR9666b-5p

Accession MIMAT0035812
Sequence

13 - 

gccaucauacguccaaccgug

 - 33

Get sequence
Deep sequencing1130 reads, 116 experiments
Evidence experimental; Illumina [1]

Mature sequence tae-miR9666b-3p

Accession MIMAT0035813
Sequence

67 - 

cgguugggcuguaugauggcga

 - 88

Get sequence
Deep sequencing129426 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).