Stem-loop sequence chi-mir-193b

AccessionMI0030667 (change log)
DescriptionCapra hircus miR-193b stem-loop
Gene family MIPF0000082; mir-193
Literature search

1 open access papers mention chi-mir-193b
(1 sentences)

Stem-loop
   -------ggag     ------- gu       u    gu    a    g  a  ag uua 
5'            gcugu       g  cccagaa cggg  uuug gggc ag ug  u   u
              |||||       |  ||||||| ||||  |||| |||| || ||  |   g
3'            cggca       c  ggguuuu gccc  aaac cccg uc ac  a   u
   gacuuagggag     gaucuua ug       c    ug    a    g  a  cu uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence chi-miR-193b-5p

Accession MIMAT0036027
Sequence

21 - 

cgggguuuugagggcgagauga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-193b-3p

Accession MIMAT0036028
Sequence

58 - 

aacuggcccacaaagucccgcu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).