Stem-loop sequence chi-mir-19b

AccessionMI0030678 (change log)
DescriptionCapra hircus miR-19b stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66730053-66730139 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-19b
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-19b-5p

Accession MIMAT0036043
Sequence

16 - 

aguuuugcagguuugcauccagc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-19b-3p

Accession MIMAT0036044
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).