Stem-loop sequence chi-mir-655

AccessionMI0030826 (change log)
DescriptionCapra hircus miR-655 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -    uuu    acu   cagg      ug           u      ua      cu   c 
5'  uucg   caga   guu    gauauu  aggagagguua ccgugu  uguucg  ugg u
    ||||   ||||   |||    ||||||  ||||||||||| ||||||  ||||||  |||  
3'  gagc   gucu   caa    cuauaa  uucucuccaau gguaca  auaagu  acu c
   g    ucc    ---   ---a      gu           u      ua      --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67125414-67125530 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-655
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
Database links

Mature sequence chi-miR-655

Accession MIMAT0036282
Sequence

71 - 

auaauacaugguuaaccucucu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).