Stem-loop sequence gma-MIR9749

AccessionMI0031038 (change log)
DescriptionGlycine max miR9749 stem-loop
Stem-loop
       g     ac        u                     u   c   uc      a 
5' gggc uauua  ugagagug gagaggugaaggaagcuaauc uga cau  aaucuu a
   |||| |||||  |||||||| ||||||||||||||||||||| ||| |||  ||||||  
3' cucg auaau  acuuucac cuuuccacuuucuucgauuag gcu gug  uuaggg u
       g     cc        c                     u   u   gc      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 13919131-13919250 [-]
intergenic
Database links

Mature sequence gma-miR9749

Accession MIMAT0036376
Sequence

81 - 

uuagcuucuuucaccuuuccc

 - 101

Get sequence
Evidence experimental; Illumina [1-3]

References

1
2
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).
3