![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR9749 |
|||||
Accession | MI0031038 (change log) | ||||
Description | Glycine max miR9749 stem-loop | ||||
Stem-loop |
g ac u u c uc a 5' gggc uauua ugagagug gagaggugaaggaagcuaauc uga cau aaucuu a |||| ||||| |||||||| ||||||||||||||||||||| ||| ||| |||||| 3' cucg auaau acuuucac cuuuccacuuucuucgauuag gcu gug uuaggg u g cc c u u gc a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR9749 |
|
Accession | MIMAT0036376 |
Sequence |
81 - uuagcuucuuucaccuuuccc - 101 |
Evidence | experimental; Illumina [1-3] |
References |
|
1 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|
2 |
PMID:25465409
"An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes"
Plant Cell. 26:4584-4601(2014).
|
3 |