Stem-loop sequence tae-MIR9775

AccessionMI0031528 (change log)
DescriptionTriticum aestivum miR9775 stem-loop
Literature search

1 open access papers mention tae-MIR9775
(1 sentences)

Stem-loop
                 cg            g        ---   c       -    c 
5' caucauauuaugug  caauaagauuuu cuaugcuu   uca cguugau ucaa c
   ||||||||||||||  |||||||||||| ||||||||   ||| ||||||| ||||  
3' gugguauaguacau  guuauucuaaaa gguacgga   agu guaacua aguu a
                 au            a        aau   u       c    a 
Get sequence
Deep sequencing
3482 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2010 in [1].

Database links

Mature sequence tae-miR9775

Accession MIMAT0036986
Sequence

11 - 

ugugcgcaauaagauuuugcua

 - 32

Get sequence
Deep sequencing1999 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).