Stem-loop sequence ame-mir-9871

AccessionMI0031797 (change log)
DescriptionApis mellifera miR-9871 stem-loop
Stem-loop
   aca   u     aaua              ga  u    u 
5'    uau gacgu    ucauccgaucuuua  gc ucua g
      ||| |||||    ||||||||||||||  || ||||  
3'    aug uugcg    agugggcuggaaau  cg aggu a
   uua   c     ----              gg  u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 27076250-27076327 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-9871
ame-mir-9871CM000054.5: 27076250-27076327 [+]
ame-mir-33CM000054.5: 27079814-27079913 [+]
Database links

Mature sequence ame-miR-9871-3p

Accession MIMAT0037275
Sequence

48 - 

ugcgguaaaggucgggugagc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).