Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: ame-miR-9871-3p
Mature
ame-miR-9871-3p
Accession
MIMAT0037275
Description
ame-miR-9871-3p mature miRNA
Hairpins
ame-mir-9871
Sequence
UGCGGUAAAGGUCGGGUGAGC
Copy Sequence
Evidence
experimental
Illumina [1]