Stem-loop sequence ame-mir-9891

AccessionMI0031818 (change log)
DescriptionApis mellifera miR-9891 stem-loop
Stem-loop
   u    g -            c   cu      u      
5'  gcgu g cggcggcggcgg ggc  ggccga ggugg 
    |||| | |||||||||||| |||  |||||| |||| a
3'  cgua c gcugcugcugcu cug  ucggcu ccacc 
   -    g a            c   cu      c      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 2775618-2775692 [-]
intergenic
Database links

Mature sequence ame-miR-9891-3p

Accession MIMAT0037296
Sequence

45 - 

ucggcuucguccucgucgucg

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).