Stem-loop sequence ame-mir-9896

AccessionMI0031823 (change log)
DescriptionApis mellifera miR-9896 stem-loop
Stem-loop
   g   ua    a            aca     cua  -gga   a 
5'  auu  uucg caauaaucggac   aucgg   aa    ucg a
    |||  |||| ||||||||||||   |||||   ||    |||  
3'  uag  aagc guuauuagccug   uagcc   uu    agc u
   a   cc    c            cag     aag  agga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 7571263-7571351 [-]
intergenic
Database links

Mature sequence ame-miR-9896-5p

Accession MIMAT0037301
Sequence

11 - 

acaauaaucggacacaaucggc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).