Stem-loop sequence pal-mir-194a

AccessionMI0032457 (change log)
DescriptionPteropus alecto miR-194a stem-loop
Stem-loop
   --u         a      gug  cu  gu 
5'    guaacagca cuccau   gg  gu  a
      ||||||||| ||||||   ||  ||   
3'    cauugucgu gaggug   cc  ca  c
   uuu         a      --a  uu  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030861.1: 7895811-7895868 [-]
intergenic
Clustered miRNAs
< 10kb from pal-mir-194a
pal-mir-194aKB030861.1: 7895811-7895868 [-]
pal-mir-215KB030861.1: 7895162-7895220 [-]
Database links

Mature sequence pal-miR-194a-5p

Accession MIMAT0040029
Sequence

1 - 

uguaacagcaacuccaugugg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-194a-3p

Accession MIMAT0040030
Sequence

37 - 

ccaguggagaugcuguuacuuu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).