Stem-loop sequence bta-mir-10164

AccessionMI0032916 (change log)
DescriptionBos taurus miR-10164 stem-loop
Stem-loop
   uu       -c          uc         gaa   aaac 
5'   cucucac  cagccaagcc  uccuaacag   ugg    u
     |||||||  ||||||||||  |||||||||   |||     
3'   gggggug  gucgguucgg  aggauuguc   acc    g
   uu       uc          --         --a   caaa 
Get sequence
Deep sequencing
974 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 53076133-53076213 [-]
intergenic
Database links

Mature sequence bta-miR-10164-3p

Accession MIMAT0040911
Sequence

49 - 

caacuguuaggaggcuuggcugc

 - 71

Get sequence
Deep sequencing968 reads, 64 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).