Stem-loop sequence bta-mir-10166

AccessionMI0032918 (change log)
DescriptionBos taurus miR-10166 stem-loop
Stem-loop
   cc   g     ug      au     a   u cac 
5'   cag cugug  cagcug  cacag cug g   g
     ||| |||||  ||||||  ||||| ||| |    
3'   guc gacac  gucgac  guguc gac c   a
   gu   a     ca      gu     g   c cag 
Get sequence
Deep sequencing
232 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 53144573-53144644 [-]
intergenic
Database links

Mature sequence bta-miR-10166-5p

Accession MIMAT0040913
Sequence

11 - 

gugcagcugaucacagacugug

 - 32

Get sequence
Deep sequencing226 reads, 57 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).