Stem-loop sequence bta-mir-10169

AccessionMI0032922 (change log)
DescriptionBos taurus miR-10169 stem-loop
Stem-loop
   cc    u  aacauca  cu      c    u    -         caca 
5'   ccau uc       ga  agcacg ucug cuuc cuuuaagac    g
     |||| ||       ||  |||||| |||| |||| |||||||||     
3'   ggug ag       cu  uugugc agac gagg gaaguucug    a
   ca    c  -------  ac      a    -    a         uccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 242218-242310 [+]
intergenic
Database links

Mature sequence bta-miR-10169-3p

Accession MIMAT0040917
Sequence

60 - 

ugaagaggagcagaacguguucau

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).