Stem-loop sequence bta-mir-10180

AccessionMI0032939 (change log)
DescriptionBos taurus miR-10180 stem-loop
Stem-loop
   cgggggcguggagccugca     u   c    c         g      -  u 
5'                    gacgg ggc cagc ugcucuucu uccugg gc a
                      ||||| ||| |||| ||||||||| |||||| || c
3'                    uuguu ucg gucg gcggggagg aggauc cg u
   ---------------acuu     c   u    c         -      a  u 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 55415411-55415504 [-]
intergenic
chr16: 55538514-55538607 [-]
intergenic
Database links

Mature sequence bta-miR-10180-3p

Accession MIMAT0040938
Sequence

65 - 

gaggaggggcgcgcugugcu

 - 84

Get sequence
Deep sequencing21 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).