![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-3479a |
||||||
Accession | MI0033108 (change log) | |||||
Description | Echinococcus granulosus miR-3479a stem-loop | |||||
Literature search |
2 open access papers mention egr-mir-3479a | |||||
Stem-loop |
--cacaac uu a uu g 5' ggugaaag u ugca uacauc g |||||||| | |||| |||||| 3' ccgcuuuc g acgu auguag u acguucua uu c -u u |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence egr-miR-3479a-5p |
|
Accession | MIMAT0041183 |
Sequence |
6 - cggugaaaguuuaugcauuua - 26 |
Evidence | experimental; Illumina [1-2] |
Mature sequence egr-miR-3479a-3p |
|
Accession | MIMAT0041184 |
Sequence |
39 - uauugcacguucuuucgccauc - 60 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:25168356
"Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus"
BMC Genomics. 15:736(2014).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|