![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-10293 |
|||||
Accession | MI0033185 (change log) | ||||
Description | Echinococcus granulosus miR-10293 stem-loop | ||||
Stem-loop |
--uc g - u cu g 5' cag ggcuc guu acucgaauuggu gc u ||| ||||| ||| |||||||||||| || g 3' guu cuggg caa ugagcuuaauca cg g cguc g a c -- g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-10293-5p |
|
Accession | MIMAT0041337 |
Sequence |
6 - gggcucguuuacucgaauuggu - 27 |
Evidence | experimental; Illumina [1-2] |
Mature sequence egr-miR-10293-3p |
|
Accession | MIMAT0041338 |
Sequence |
41 - uaauucgagucaacagggucguu - 63 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:25168356
"Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus"
BMC Genomics. 15:736(2014).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|