Stem-loop sequence bdo-mir-315

AccessionMI0037267 (change log)
DescriptionBactrocera dorsalis miR-315 stem-loop
Literature search

1 open access papers mention bdo-mir-315
(1 sentences)

Stem-loop
   -               a       --   u 
5'  uuuugauuguugcuc gaaagcc  cuu a
    ||||||||||||||| |||||||  ||| u
3'  aaaauuaauaacgag cuuucgg  gag u
   c               -       ac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00100: 130753-130811 [+]
intergenic
Database links

Mature sequence bdo-miR-315

Accession MIMAT0045390
Sequence

1 - 

uuuugauuguugcucagaaagcc

 - 23

Get sequence
Evidence experimental; Torrent [1]

References

1