Stem-loop sequence bdo-mir-275

AccessionMI0037271 (change log)
DescriptionBactrocera dorsalis miR-275 stem-loop
Literature search

1 open access papers mention bdo-mir-275
(2 sentences)

Stem-loop
   --       -a    ug   gg     gg   u 
5'   cgcgcua  ucag  acc  ggcug  uug u
     |||||||  ||||  |||  |||||  ||| a
3'   gcgcgau  aguc  ugg  cugac  aau u
   gc       ga    ca   -a     gg   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold03687: 2784-2848 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-275
bdo-mir-275scaffold03687: 2784-2848 [-]
bdo-mir-305scaffold03687: 2586-2645 [-]
Database links

Mature sequence bdo-miR-275

Accession MIMAT0045394
Sequence

43 - 

ucagguaccugaaguagcgcgcg

 - 65

Get sequence
Evidence experimental; Torrent [1]

References

1