Stem-loop sequence bdo-mir-304

AccessionMI0037321 (change log)
DescriptionBactrocera dorsalis miR-304 stem-loop
Literature search

1 open access papers mention bdo-mir-304
(2 sentences)

Stem-loop
   --       aauu      u     cgaa    au 
5'   uaaucuc    uguaac gugag    uucg  a
     |||||||    |||||| |||||    ||||   
3'   guuagag    acguug cacuc    aagu  u
   cc       guau      -     ----    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00073: 1266554-1266618 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-304
bdo-mir-283scaffold00073: 1264481-1264547 [+]
bdo-mir-304scaffold00073: 1266554-1266618 [+]
bdo-mir-12scaffold00073: 1266978-1267045 [+]
Database links

Mature sequence bdo-miR-304

Accession MIMAT0045442
Sequence

1 - 

uaaucucaauuuguaacugugag

 - 23

Get sequence
Evidence experimental; Torrent [1]

References

1