Stem-loop sequence mes-MIR171l

AccessionMI0037904 (change log)
DescriptionManihot esculenta miR171l stem-loop
Literature search

7 open access papers mention mes-MIR171l
(16 sentences)

Stem-loop
   g     g   c  c          ca      a  u   acuggaucuuccauaacuagccagg 
5'  aagua aca gg gugauauugg  cggcuc uc ucu                         a
    ||||| ||| || ||||||||||  |||||| || |||                          
3'  uucgu ugu uc cacuauaacc  gccgag ag aga                         u
   -     a   -  u          aa      c  c   agaagaaguaaaauaguucuuuacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07330: 183561-183688 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR171l
mes-MIR171lscaffold07330: 183561-183688 [+]
mes-MIR171dscaffold07330: 183574-183676 [-]
Database links

Mature sequence mes-miR171l

Accession MIMAT0045968
Sequence

98 - 

cgagccgaaccaauaucacuc

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).