Stem-loop sequence mes-MIR390b

AccessionMI0037905 (change log)
DescriptionManihot esculenta miR390b stem-loop
Literature search

2 open access papers mention mes-MIR390b
(11 sentences)

Stem-loop
   -   cu    a          g            aagcaaugauaaugguuauugauuuuuggguu 
5'  aga  cugu aagcucagga ggauagcgccau                                a
    |||  |||| |||||||||| ||||||||||||                                a
3'  ucu  gaca uuugaguccu ucuaucgcggua                                u
   u   ug    c          a            auuacauaaaaaaaaaaaaaaaaaaaaacauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01061: 102509-102642 [-]
intergenic
Database links

Mature sequence mes-miR390b

Accession MIMAT0045969
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).