Stem-loop sequence mes-MIR399h

AccessionMI0037908 (change log)
DescriptionManihot esculenta miR399h stem-loop
Literature search

7 open access papers mention mes-MIR399h
(10 sentences)

Stem-loop
   -      ug       c     gc        ca ug    cauga   gg g 
5'  agcagu  uagggca cucuc  uuggcagg  a  gcag     gaa  u u
    ||||||  ||||||| |||||  ||||||||  |  ||||     |||  |  
3'  ucguua  gucccgu gagag  aaccguuc  u  uguc     cuu  g u
   u      gu       c     ga        -- gu    -ccag   aa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11425: 529448-529551 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399h
mes-MIR399hscaffold11425: 529448-529551 [+]
mes-MIR399fscaffold11425: 531795-531894 [+]
Database links

Mature sequence mes-miR399h

Accession MIMAT0045972
Sequence

11 - 

gggcaccucucgcuuggcagg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).