Stem-loop sequence mes-MIR477j

AccessionMI0037909 (change log)
DescriptionManihot esculenta miR477j stem-loop
Literature search

3 open access papers mention mes-MIR477j
(6 sentences)

Stem-loop
   --uaauuaaga        ca               a     u    ccaa      g 
5'            auggcagc  uuguucacucucccu aaggc ucaa    uuugug a
              ||||||||  ||||||||||||||| ||||| ||||    |||||| c
3'            uacugucg  aauaggugagaggga uuccg aguu    aaacac u
   aucguuuuuag        aa               a     u    --cg      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03581: 762703-762817 [-]
intergenic
Database links

Mature sequence mes-miR477j

Accession MIMAT0045973
Sequence

26 - 

acucucccuaaaggcuucaac

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).