Stem-loop sequence mes-MIR477k

AccessionMI0037910 (change log)
DescriptionManihot esculenta miR477k stem-loop
Literature search

3 open access papers mention mes-MIR477k
(11 sentences)

Stem-loop
   --uuuc  uu    g     g   cu         -u            auaugugcccuagcaugcaugcauccaagcuauaaaaga 
5'       cu  caag uauug uug  cacucuccc  caagagcuucuc                                       a
         ||  |||| ||||| |||  |||||||||  ||||||||||||                                        
3'       ga  guuc gugac aac  gugagaggg  guucucgaagag                                       g
   acuacc  uc    a     g   ag         uc            cguagcuuugagucgacuagcuuucgcaacaaaaaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06716: 23178-23352 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477k
mes-MIR477kscaffold06716: 23178-23352 [+]
mes-MIR477iscaffold06716: 23382-23488 [+]
mes-MIR477ascaffold06716: 23691-23769 [+]
Database links

Mature sequence mes-miR477k

Accession MIMAT0045974
Sequence

26 - 

acucucccucaagagcuucuc

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).