Stem-loop sequence mes-MIR2118

AccessionMI0037911 (change log)
DescriptionManihot esculenta miR2118 stem-loop
Literature search

3 open access papers mention mes-MIR2118
(19 sentences)

Stem-loop
   -----gauu     u      ugc                 -          aauuuaaagag    g 
5'          aagcc cccaga   agaguggaaaugggugg augggaguga           ucug u
            ||||| ||||||   ||||||||||||||||| ||||||||||           ||||  
3'          uuugg gggucu   ucuuaucuuuacccacc uacccuugcu           agau g
   uuuucccuc     -      --u                 g          ---------aa    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08359: 1293624-1293743 [+]
intergenic
Database links

Mature sequence mes-miR2118

Accession MIMAT0045975
Sequence

74 - 

guucccaugccacccauuucua

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).