Stem-loop sequence mes-MIR482c

AccessionMI0037913 (change log)
DescriptionManihot esculenta miR482c stem-loop
Stem-loop
   -ga      -uu     ga     g           -a     c      -    -   -      u 
5'    gagggg   gcugg  gcuau gguaugggggg  uuggg aaaauu gcuu ggc uuuguu a
      ||||||   |||||  ||||| |||||||||||  ||||| |||||| |||| ||| ||||||  
3'    cuccuu   cgacc  cggug ccauacccucc  aaccc uuuuag cgaa ucg agacga u
   ccc      ugu     uc     a           ag     u      u    a   g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03604: 533085-533214 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR482c
mes-MIR482dscaffold03604: 533334-533446 [-]
mes-MIR482cscaffold03604: 533085-533214 [-]
Database links

Mature sequence mes-miR482c

Accession MIMAT0045977
Sequence

84 - 

uuuucccaagaccucccauacc

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).