Stem-loop sequence mes-MIR482d

AccessionMI0037914 (change log)
DescriptionManihot esculenta miR482d stem-loop
Literature search

1 open access papers mention mes-MIR482d
(1 sentences)

Stem-loop
   ---      -ugcua        ua      a       -c            aaa  a 
5'    agagag      gaggaagu  auggag ugggugg  ucgggaagaaga   ag g
      ||||||      ||||||||  |||||| |||||||  ||||||||||||   ||  
3'    ucucuc      cuccuuca  uaccuu acccacc  agcccuucuucu   uc g
   cuu      uucaac        cc      -       ac            -ga  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03604: 533334-533446 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR482d
mes-MIR482dscaffold03604: 533334-533446 [-]
mes-MIR482cscaffold03604: 533085-533214 [-]
Database links

Mature sequence mes-miR482d

Accession MIMAT0045978
Sequence

67 - 

uucccgacaccacccauuccau

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).