Stem-loop sequence mes-MIR3627

AccessionMI0037919 (change log)
DescriptionManihot esculenta miR3627 stem-loop
Literature search

1 open access papers mention mes-MIR3627
(1 sentences)

Stem-loop
   ug     a        c    g  g      -cug    ccg 
5'   gggga ucuugucg agga cg uggcac    ccgg   a
     ||||| |||||||| |||| || ||||||    ||||    
3'   ucccu agaacagu uccu gc accgug    ggcu   u
   cg     c        u    -  g      aaaa    acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03418: 2111-2194 [+]
intergenic
Database links

Mature sequence mes-miR3627

Accession MIMAT0045983
Sequence

11 - 

uugucgcaggagcgguggcacc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).