Stem-loop sequence mes-MIR9386

AccessionMI0037921 (change log)
DescriptionManihot esculenta miR9386 stem-loop
Literature search

1 open access papers mention mes-MIR9386
(3 sentences)

Stem-loop
   ---augg        ua  c    a            c            auuuuc  ga    uu 
5'        ggaagcuu  gc caau cucuuugcaguu gaaaguggaagc      gc  cucc  c
          ||||||||  || |||| |||||||||||| ||||||||||||      ||  ||||  g
3'        uuuucgag  ug guua gggaaacguuaa cuuucgccuucg      cg  gagg  a
   gugucug        -c  a    a            -            -----a  ac    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02373: 78611-78735 [-]
intergenic
Database links

Mature sequence mes-miR9386

Accession MIMAT0045985
Sequence

26 - 

uuugcaguucgaaaguggaagc

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).