Stem-loop sequence mes-MIR169ad

AccessionMI0037922 (change log)
DescriptionManihot esculenta miR169ad stem-loop
Literature search

10 open access papers mention mes-MIR169ad
(28 sentences)

Stem-loop
   a    c   a        -           cu   -        a     ugcugguuugcauuucucguaugca 
5'  gagg aua caugaaga uaagagucugu  gau agccaagg ugacu                         a
    |||| ||| |||||||| |||||||||||  ||| |||||||| |||||                          
3'  uucc uau guacuuuu auucucggaca  uua ucgguucc acuga                         a
   c    a   c        u           cu   a        -     cggacuuuggaugaguucccgacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 24104-24252 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169ad
mes-MIR169uscaffold05005: 20259-20360 [+]
mes-MIR169zscaffold05005: 23017-23111 [-]
mes-MIR169wscaffold05005: 23286-23394 [-]
mes-MIR169adscaffold05005: 24104-24252 [+]
mes-MIR169vscaffold05005: 24359-24464 [+]
Database links

Mature sequence mes-miR169ad

Accession MIMAT0045986
Sequence

118 - 

ucacaggcucuuauuuuucaug

 - 139

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).