Stem-loop sequence mes-MIR11892

AccessionMI0037924 (change log)
DescriptionManihot esculenta miR11892 stem-loop
Literature search

1 open access papers mention mes-MIR11892
(8 sentences)

Stem-loop
   -      ---g      uc            u          u  cugg     g 
5'  caaugu    cuuuug  aucucaaccuug gucagauuuu gu    uucuc c
    ||||||    ||||||  |||||||||||| |||||||||| ||    |||||  
3'  guuacg    gaaaac  uggaguuggaac cagucuaaaa ca    aaggg a
   u      auua      ga            u          -  ---a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09889: 5902-6005 [-]
intergenic
Database links

Mature sequence mes-miR11892

Accession MIMAT0045988
Sequence

11 - 

uugucaucucaaccuuguguc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).