Stem-loop sequence aae-mir-11899-1

AccessionMI0037939 (change log)
DescriptionAedes aegypti miR-11899-1 stem-loop
Literature search

1 open access papers mention aae-mir-11899-1
(1 sentences)

Stem-loop
   u uu        gauu           ugcaguu 
5'  g  ccauguau    ucggucaugua       g
    |  ||||||||    |||||||||||        
3'  c  gguauaua    agccaguauau       a
   a uc        auuu           uaauaaa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.1446: 67709-67778 [-]
intergenic
Database links

Mature sequence aae-miR-11899

Accession MIMAT0045998
Sequence

46 - 

uaugaccgauuuaauauauggcu

 - 68

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).