Stem-loop sequence aae-mir-11914-2

AccessionMI0037958 (change log)
DescriptionAedes aegypti miR-11914-2 stem-loop
Literature search

1 open access papers mention aae-mir-11914-2
(3 sentences)

Stem-loop
   ca   c              u    acu 
5'   agu acuuuuuagugacu gguc   u
     ||| |||||||||||||| ||||   u
3'   uca ugaaaaaucacugg cuag   u
   ua   c              u    cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.222: 1778750-1778808 [-]
intergenic
Database links

Mature sequence aae-miR-11914

Accession MIMAT0046013
Sequence

5 - 

ucacuuuuuagugacuugguc

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).