Stem-loop sequence gga-mir-1388b

AccessionMI0040705 (change log)
DescriptionGallus gallus miR-1388b stem-loop
Literature search

1 open access papers mention gga-mir-1388b
(1 sentences)

Stem-loop
   -cau      acg         ---u   cc u 
5'     gggcug   aaccugaga    uga  c c
       ||||||   |||||||||    |||  |  
3'     ccugac   uuggacucu    acu  g a
   agcu      aga         uacc   uu u 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 9710466-9710529 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1388b
gga-mir-1388bchr20: 9710466-9710529 [-]
gga-mir-1388achr20: 9710454-9710541 [+]
Database links

Mature sequence gga-miR-1388b-5p

Accession MIMAT0049974
Sequence

1 - 

caugggcugacgaaccugagauu

 - 23

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-1388b-3p

Accession MIMAT0049975
Sequence

42 - 

uucucagguuagacaguccucg

 - 63

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).