Stem-loop sequence mdo-mir-9c-3

AccessionMI0040781 (change log)
DescriptionMonodelphis domestica miR-9c-3 stem-loop
Stem-loop
   --uuc            u     uagcuc 
5'      gguuaucuagcu uauga      a
        |||||||||||| |||||       
3'      ccaauagaucga auacu      a
   agaaa            c     cacaau 
Get sequence
Deep sequencing
1327 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 122711587-122711644 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-9c-3
mdo-mir-9a-1chr1: 122711570-122711659 [-]
mdo-mir-9c-3chr1: 122711587-122711644 [+]
Database links

Mature sequence mdo-miR-9c-5p

Accession MIMAT0050101
Sequence

1 - 

uucgguuaucuagcuuuauga

 - 21

Get sequence
Deep sequencing3778 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-9c-3p

Accession MIMAT0050102
Sequence

38 - 

auacagcuagauaaccaaaga

 - 58

Get sequence
Deep sequencing153 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).