Stem-loop sequence mdo-mir-3600

AccessionMI0040836 (change log)
DescriptionMonodelphis domestica miR-3600 stem-loop
Stem-loop
   --          ac    -       --g  gg 
5'   caguucuuca  uggc agcuuua   cu  g
     ||||||||||  |||| |||||||   ||   
3'   gucaagaagu  accg ucgaaau   ga  a
   uc          -c    c       aca  ac 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 517205535-517205596 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-3600
mdo-mir-22chr2: 517205525-517205605 [-]
mdo-mir-3600chr2: 517205535-517205596 [+]
mdo-mir-7268chr2: 517205669-517205727 [-]
Database links

Mature sequence mdo-miR-3600-3p

Accession MIMAT0050195
Sequence

40 - 

aagcucgccacugaagaacugc

 - 61

Get sequence
Deep sequencing30 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).