Stem-loop sequence mdo-mir-9c-2

AccessionMI0040846 (change log)
DescriptionMonodelphis domestica miR-9c-2 stem-loop
Stem-loop
   --uuc            u     agacc 
5'      gguuaucuagcu uauga     a
        |||||||||||| |||||      
3'      ccaauagaucga auacu     a
   agaaa            c     cacau 
Get sequence
Deep sequencing
1302 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 215711861-215711916 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-9c-2
mdo-mir-9c-2chr3: 215711861-215711916 [-]
mdo-mir-9a-2chr3: 215711846-215711932 [+]
Database links

Mature sequence mdo-miR-9c-5p

Accession MIMAT0050101
Sequence

1 - 

uucgguuaucuagcuuuauga

 - 21

Get sequence
Deep sequencing3778 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-9c-3p

Accession MIMAT0050102
Sequence

36 - 

auacagcuagauaaccaaaga

 - 56

Get sequence
Deep sequencing153 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).