Stem-loop sequence mdo-mir-122b

AccessionMI0040849 (change log)
DescriptionMonodelphis domestica miR-122b stem-loop
Stem-loop
   --uuu             c     auaga 
5'      agugugauaaugg guuug     c
        ||||||||||||| |||||      
3'      ucacacuguuacc caaac     u
   auacc             a     acagg 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 247368074-247368131 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-122b
mdo-mir-122chr3: 247368064-247368137 [-]
mdo-mir-122bchr3: 247368074-247368131 [+]
Database links

Mature sequence mdo-miR-122b-5p

Accession MIMAT0050214
Sequence

1 - 

uuuagugugauaauggcguuug

 - 22

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-122b-3p

Accession MIMAT0050215
Sequence

36 - 

aaacaccauugucacacuccau

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).